| Description | Inquire | When apoptosis occurs, some DNA endonucleases will be activated. These endonucleases will cut off genomic DNA between nucleosomes and produce 180 bp-200 BP DNA fragments, which appear as a specific ladder pattern in agarose gel electrophoresis. When double strand or single strand breaks occurWhen apoptosis occurs, some DNA endonucleases will be activated. These endonucleases will cut off genomic DNA between nucleosomes and produce 180 bp-200 BP DNA fragments, which appear as a specific ladder pattern in agarose gel electrophoresis. When double strand or single strand breaks occur in genomic DNA, a large number of sticky 3'-oh ends will be generated, which can interact with YF under the catalysis of deoxyribonucleotide terminal transferase (TDT) ®/ CY dUTP binding can directly detect apoptotic cells by fluorescence microscopy or flow cytometry. This kind of method is called terminal deoxynucleotidyl transferase mediated nick end labeling (TUNEL). Because normal or proliferating cells have almost no DNA breaks, there is no 3'-oh formation and they can rarely be stained. TUNEL method can stain intact single apoptotic nuclei or apoptotic bodies in situ, can accurately reflect the typical biochemical and morphological characteristics of apoptosis, and can detect a very small number of apoptotic cells, so it is widely used in the study of apoptosis. This kit has a wide range of applications and can be used to detect apoptosis in frozen or paraffin sections, as well as cultured adherent cells or suspended cells. It can selectively detect apoptotic cells, but not necrotic cells or cells with DNA strand breaks caused by irradiation and drug treatment. This kit detects cell apoptosis with a short time-consuming, one-step staining reaction and can be detected after washing.Component： Instruction： Experimental materials (self provided)PBS buffer (1 x, pH~7.4). 0.2% Triton X -100 (PBS formulation). 0.1% Triton X -100 (PBS formulation, containing 5 mg/mLBSA)4% paraformaldehyde (prepared with PBS)Immunohistochemical penDewaxing solvent (paraffin section sample)Related reagents for paraffin section processingAnti fluorescence quenching and sealing agent. ddH2Oexperimental design. A. Positive control:Prepare positive control slides using DNaseI treatment. DNaseI can digest single or double stranded DNA and expose the 3 '- OH end, artificially causing cell apoptosis. One experiment per time is sufficient. (To verify if there are any issues with the experimental operation and reagent kit)B. Negative control:Use TUNEL Reaction Buffer without TdT Enzyme and replace TdT Enzyme with ddH2O. (Mainly to exclude non-specific staining caused by cell apoptosis, operational processes, and other reasons; and to adjust the exposure intensity of the shooting.)C. Experimental processing group.The experimental group operated normally according to the instructions.D. Experimental control group.The experimental group operated normally according to the instructions.Experimental steps1. Sample preparation:(1) For adherent cells or cell smearsa. Clean once with PBS.Note: If you are concerned that the cells on the cell smear may not adhere firmly, you can dry the sample to make the cells adhere more firmly.b. Fixation: Add an appropriate amount of 4% paraformaldehyde (prepared with PBS) and fix at 4 ℃ for 30 minutes. Clean twice with PBS.c. Translucency: Add an appropriate amount of 0.2% Triton X -100 (prepared with PBS) and let it penetrate at room temperature for 20 minutes. Clean twice with PBS.d. Step 2: TUNEL reaction.(2) For suspended cells or cell suspensionsa. Collect cells (3-5 x 106 cells), centrifuge at 1000 rpm for 5 minutes, and wash twice with PBS.b. Fixation: Add an appropriate amount of 4% paraformaldehyde (prepared with PBS) and resuspend the cells thoroughly. Fix at 4 ℃ for 30 minutes. Centrifuge at 2000 rpm for 5 minutes and clean twice with PBS.c. Translucency: Add an appropriate amount of 0.2% Triton X -100 (prepared with PBS) and let it penetrate at room temperature for 20 minutes. Centrifuge at 2000 rpm for 5 minutes and clean twice with PBS.d. Step 2: TUNEL reaction.(3) Paraffin tissue sectioninga. Dewaxing and hydration: Place the sliced samples sequentially in xylene I (10 min) → xylene II (10 min) → 100% ethanol I (5 min) → 100% ethanol II (5 min) → 95% ethanol (5 min) → 90% ethanol (5 min) → 80% ethanol (5 min) → 70% ethanol (5 min) → ddH2O rinse for 5 min, rinse twice.Note: Xylene is toxic and volatile. Please perform this operation in a fume hood.b. Use filter paper to dry the liquid around the sliced sample, and circle the sample contour with an immunohistochemical pen for downstream transparency and labeling.Note: If it is found that the contour circle of immunohistochemistry strokes is damaged in subsequent experimental operations, it needs to be redrawn in a timely manner.c. Transparency: Dilute 2 mg/mL of ProteinaseK solution with PBS in a ratio of 1:100 to a final concentration of 20 µ g/mL. Add 100 µ L dropwise to each sample to cover all sample areas. Incubate at 20-37 ℃ for 20 minutes.Note: Protein K can penetrate the cell membrane and nuclear membrane, allowing subsequent staining reagents to fully enter the nucleus for reaction and improve labeling efficiency. An excessively long incubation time increases the risk of tissue slices falling off the carrier film during subsequent washing steps, while a too short incubation time may result in insufficient permeability treatment and affect labeling efficiency. To obtain better results, the concentration, incubation time, and temperature of Protein K need to be optimized according to different types of tissue samples.d. Wash the slices twice with PBS, each time for 5 minutes. Use filter paper to remove excess liquid, and place the processed sample in a wet box to keep it moist.Note: Protein K must be washed thoroughly in this step, otherwise it will seriously interfere with subsequent labeling reactions.e. Step 2: TUNEL reaction.(4) Frozen tissue sectionsa. Fixation: Take out frozen sections and warm them back to room temperature. Add an appropriate amount of 4% paraformaldehyde (prepared with PBS) and fix at room temperature for 30 minutes. Wash twice with PBS for 10 minutes each time.Note: If you are concerned that formaldehyde cleaning may not be clean enough, it may affect the final dyeing effect. After formaldehyde fixation is completed, an appropriate amount of 2 mg/mL glycine can be added and washed for 10 minutes to neutralize the residual fixing solution, and then PBS cleaning can be carried out.b. Use filter paper to dry the liquid around the sliced sample, and circle the sample contour with an immunohistochemical pen for downstream transparency and labeling.Note: If it is found that the contour circle of immunohistochemistry strokes is damaged in subsequent experimental operations, it needs to be redrawn in a timely manner.c. Transparency: Dilute 2 mg/mL of ProteinaseK solution with PBS in a ratio of 1:100 to a final concentration of 20 µ g/mL. Add 100 µ L dropwise to each sample to cover all sample areas. Incubate at 20-37 ℃ for 20 minutes.Note: Protein K can penetrate the cell membrane and nuclear membrane, allowing subsequent staining reagents to fully enter the nucleus for reaction and improve labeling efficiency. An excessively long incubation time increases the risk of tissue slices falling off the carrier film during subsequent washing steps, while a too short incubation time may result in insufficient permeability treatment and affect labeling efficiency. To obtain better results, the concentration, incubation time, and temperature of Protein K need to be optimized according to different types of tissue samples.d. Wash the slices twice with PBS, each time for 5 minutes. Use filter paper to remove excess liquid, and place the processed sample in a wet box to keep it moist.Note: Protein K must be washed thoroughly in this step, otherwise it will seriously interfere with subsequent labeling reactions.e. Step 2: TUNEL reaction.(5) Positive treatment (only the positive control is subjected to this step, and other samples are directly subjected to the TUNEL reaction step)a. Dilute 10 x DNase I Buffer with ddH2O in a ratio of 1:10 to 1 x DNase I Buffer for later use.b. Drip 100 µ L of 1xDNase I Buffer onto the processed sample, covering all sample areas, and equilibrate at room temperature for 5 minutes.c. Dilute DNase I (2 U) with 1 x DNase I Buffer at a ratio of 1:100/ µ L) A working solution with a final concentration of 20 U/mL.d. Discard the buffer and add 100 µ Incubate DNase I working solution with a concentration of 20 U/mL at room temperature for 10 minutes.e. Discard DNase I working solution and clean twice with PBS.f. Step 2: TUNEL reaction.2. TUNEL reaction(1) Prepare TUNEL reaction solution (ready to use):/1 sample5sample10 sampleTdT enzyme1 µL5 µL10 µLYF®488/555/594/640 TUNEL Reaction Buffer49 µL245 µL490 µLTUNEL Total volume of reaction solution50 µL250 µL500 µL(2) For adherent cells, cell smears, or tissue sectionsa. Add 50 to each sample µ L TUNEL reaction solution, evenly cover the sample with the reaction solution. The appropriate time for dark incubation at 37 ℃ (recommended staining time for cells is 30 minutes to 1 hour, and tissue staining time is 2 hours).Note: 50 µ L TUNEL reaction solution is suitable for smear, slicing, or 96 well plates (other different well plates can adjust the volume of TUNEL reaction solution appropriately to cover cells). If the sample to be tested is a smear, slice, or in a 24 well plate, 12 well plate, or 6 well plate, anti evaporation film can be used, or self sealing bags or other appropriate materials can be used to cut circular plastic sheets slightly smaller than the holes. After adding TUNEL reaction solution dropwise, cover the sample to prevent the evaporation of TUNEL reaction solution and make the TUNEL reaction solution evenly cover the sample.b. Discard the TUNEL reaction solution, wash twice with PBS, and then wash three times with 0.1% Triton X -100 (PBS preparation, containing 5 mg/mL BSA) for 5 minutes each time. This way, free unreacted markers can be removed cleanly.c. (Optional) Add an appropriate concentration of 5 to each sample µ DAPI staining solution with a concentration of g/mL, incubated at room temperature in dark for 5 minutes. After staining, discard DAPI staining solution and wash twice with PBS for 5 minutes each time.d. (Optional) Slice sealing: Add 50 drops to each sample µ L anti fluorescence quenching sealing agent (anti fluorescence quenching sealing agent may not be suitable for certain dyes, it is recommended to conduct pre experimental testing for compatibility before the experiment), cover the cover glass, gently tap the cover glass with the blunt end of tweezers to remove bubbles and ensure complete sealing.e. Use filter paper to remove excess liquid and add 100 to the sample area µ Keep the sample moist with PBS and immediately observe under a fluorescence microscope.(3) For suspended cells or cell suspensionsa. Add 50 to each sample tube µ Gently resuspend cells in LTUNEL reaction solution and incubate at 37 ℃ in the dark for 30-1 hour. Gently resuspend cells with a micropipette every 15 minutes.b. Centrifuge at 2000 rpm for 5 minutes, discard TUNEL reaction solution, and wash twice with 0.1% Triton X -100 (PBS preparation, containing 5 mg/mLBSA) for 5 minutes each time. This way, free unreacted markers can be removed cleanly.c. Add 100 to each sample tube µ L concentration is 5 µ DAPI staining solution with a concentration of g/mL, incubated at room temperature in dark for 5 minutes.d. Join 400 µ L PBS resuspended cells and immediately detected with a flow cytometer or observed under a fluorescence microscope after smearing.Matters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. when the staining background is heavy or non-specific staining is obvious, the staining time can be appropriately reduced. 3. it is recommended to add negative control and positive control groups during the experiment. 4. please wear mask and gloves when using component A. if it contacts the skin, please wash it with plenty of water immediately. 5. fluorescent dyes have quenching problems. Please try to avoid light to slow down fluorescence quenching. 6. for your safety and health, please wear experimental clothes and disposable gloves.Product parameters：490/515 nm；Scope of application：Late apoptosis detection, TUNEL Kit... Read More | Product content:E665636Component50 TStorageE665636ABuffer P115 mLRTE665636BBuffer P215 mLRTE665636CBuffer E315 mLRTE665636DBuffer PS15 mLRTE665636EBuffer PW (concentrate)10 mLRTE665636FEndo-Free Buffer EB10 mLRTE665636GRNase A (10 mg/mL)150 µLRTE665636HEndo-Remover FMwith Collection Tubes50 Product content:E665636Component50 TStorageE665636ABuffer P115 mLRTE665636BBuffer P215 mLRTE665636CBuffer E315 mLRTE665636DBuffer PS15 mLRTE665636EBuffer PW (concentrate)10 mLRTE665636FEndo-Free Buffer EB10 mLRTE665636GRNase A (10 mg/mL)150 µLRTE665636HEndo-Remover FMwith Collection Tubes50 EARTE665636ISpin Columns DMwith Collection Tubes50 EART Product Introduction:Endotoxins are a common pollutant in plasmid extraction. Due to the high sensitivity of eukaryotic cells to endotoxins, the presence of endotoxins in plasmids can greatly reduce the transfection efficiency of eukaryotic cells. This reagent kit provides a simple, fast, and efficient new method for extracting endotoxin free plasmids. The extracted plasmids remove endotoxins to the maximum extent possible and can effectively remove contamination of genomic DNA, RNA, proteins, etc. The operation is simple and convenient. This reagent kit is suitable for extracting 1-5mL of bacterial solution. On the basis of alkaline lysis of cells, it efficiently and specifically binds plasmid DNA through a new silicon-based membrane. Each adsorption column can adsorb up to 40% µ The plasmid DNA of g is effectively removed using a special buffer system and endotoxin removal filter column, effectively removing impurities such as endotoxins and proteins. The plasmid obtained from this kit has high purity and stable quality, making it particularly suitable for cell transfection. It can also be used for downstream experiments such as DNA sequencing, PCR, PCR based mutations, in vitro transcription, transformed bacteria, and endonuclease digestion.Self prepared reagents: anhydrous ethanol, isopropanol.Preparation and important precautions before the experiment：1. All components can be stably stored for 1 year in a dry, room temperature (15-30 ℃) environment. The adsorption column can be stored for a longer time at 2-8 ℃. Buffer P1 with RNase A added can be stably stored for 6 months at 2-8 ℃. 2. Before the first use, add all RNase A solution to Buffer P1, mix well, and store at 2-8 ℃. Before use, let it sit at room temperature for a period of time. After returning to room temperature, use.3.Before the first use, anhydrous ethanol should be added to the Buffer PW according to the instructions on the reagent bottle label.4. Before use, please check if there is any crystallization or precipitation in Buffer P2 and Buffer E3. If there is any crystallization or precipitation, you can take a water bath at 37 ℃ for a few minutes to restore clarity.5. Be careful not to come into direct contact with Buffer P2 and Buffer E3, and immediately cover them tightly after use.6.The amount and purity of plasmid extraction are related to factors such as bacterial culture concentration, strain type, plasmid size, and plasmid copy number.Operation steps：1. Take 1-5 mL of overnight cultured bacterial solution and add it to a centrifuge tube (provided). Centrifuge at 13000 rpm (~16200 × g) for 30 seconds to collect bacteria, and try to discard all the supernatant as much as possible.2. Add 250 to the centrifuge tube containing bacterial sediment µ L Buffer P1 (please check if RNase A has been added first), mix thoroughly with a pipette or vortex oscillator, and suspend bacterial precipitation.Attention: If the bacterial blocks are not thoroughly mixed, it will affect the cracking effect, resulting in low extraction amount and purity.3. Add 250 to the centrifuge tube µ L Buffer P2, gently invert and mix 8-10 times, allowing the bacterial cells to fully lyse. Leave at room temperature for 3-5 minutes. At this point, the solution should become clear and viscous.Attention: Mix gently and do not shake vigorously to avoid interrupting genomic DNA and mixing genomic DNA fragments in the extracted plasmid. If the solution does not become clear, it indicates that the bacterial count may be too high and the lysis may not be complete. The bacterial count should be reduced.4. Add 250 to the centrifuge tube µ L Buffer E3, immediately invert and mix 8-10 times until white flocculent precipitates appear. Let it stand at room temperature for 5 minutes. Centrifuge at 13000 rpm for 5 minutes, extract the supernatant, and add it to a filter column (Endo Remove FM). Centrifuge at 13000 rpm for 1 minute to filter, and collect the filtrate in a centrifuge tube (self provided).Attention: After adding Buffer E3, it should be mixed evenly immediately to avoid local precipitation. 5. Add 225 to the filtrate µ Mix L isopropanol upside down.6. Column balance: Add 200 to the spin columns DM that have been loaded into the collection tube µ L Buffer PS, centrifuge at 13000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.7. Transfer the mixed solution of filtrate and isopropanol from step 5 to an equilibrium adsorption column (already loaded into a collection tube).8.13000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.Attention: The maximum volume of the adsorption column is 750 µ L. If the sample volume is greater than 750 µ L can be added in batches. 9. Add 750 to the adsorption column µ L Buffer PW (please check if anhydrous ethanol has been added first), centrifuge at 13000 rpm for 1 minute, and discard the waste liquid in the collection tube.10. Place the adsorption column back into the recovery manifold and centrifuge at 13000 rpm for 1 minute. Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).11. Place the adsorption column in a new collection tube and add 50-100 to the middle of the adsorption membrane µ L Endo Free Buffer EB, let it stand at room temperature for 2-5 minutes, centrifuge at 13000 rpm for 2 minutes, and collect the plasmid solution into a centrifuge tube- Store the plasmid at 20 ℃.Note: 1) To increase the efficiency of plasmid recovery, the obtained solution can be added back to the adsorption column, left at room temperature for 2-5 minutes, centrifuged at 13000 rpm for 2 minutes, and collected into a centrifuge tube.2) When the plasmid copy number is low or>10 kb, preheating the Endo Free Buffer EB in a water bath at 65-70 ℃ can increase the extraction efficiency... Read More | Product content: M665794Component125 TStorageM665794A2×miRNA qPCR Mixture (ROX)2×750 µL-20℃. Avoid freeze/thaw cycleM665794BReverse Primer, 10 µM60 µL-20℃. Avoid freeze/thaw cycleM665794CddH2O1.5 mL-20℃. Avoid freeze/thaw cycle Product Introduction:This kitProduct content: M665794Component125 TStorageM665794A2×miRNA qPCR Mixture (ROX)2×750 µL-20℃. Avoid freeze/thaw cycleM665794BReverse Primer, 10 µM60 µL-20℃. Avoid freeze/thaw cycleM665794CddH2O1.5 mL-20℃. Avoid freeze/thaw cycle Product Introduction:This kit uses the principle of SYBR Green I chimeric fluorescent dye method for miRNA fluorescence quantitative PCR detection. The kit includes 2 x miRNA qPCR Mixture and Reverse Primer required for detection. 2 x miRNA qPCR Mixture is a new generation pre mixed form of fluorescence quantitative PCR detection reagent specially developed for miRNA quantitative detection. The fluorescent dye SYBR Green I contained in it can bind to all double stranded DNA, making the product suitable for detecting different target sequences without the need to synthesize specific labeled probes. The GoldStar Taq DNA polymerase is a chemically modified and highly efficient thermal starter enzyme, coupled with a unique buffer system, which enhances reaction specificity, sensitivity, and enables accurate quantification of miRNA over a wider range. The 2x miRNA qPCR Mixture contains ROX dye and is suitable for fluorescence quantitative PCR instruments that require ROX as a calibration dye.Note: This kit must be used in conjunction with the miRNA cDNA first strand synthesis kit.Self prepared experimental materials: qPCR upstream primer.Forward Primer design principles:1. Follow the most common principles of primer design.2.Based on mature miRNA sequences, replacing U with T is the most basic and simplest design method.3.The Tm value of the downstream primer provided in the reagent kit is 63.6 ℃, and the Tm value of the upstream primer should be designed to be around 63.6 ℃ as much as possible.4. If the Tm value of the primer directly designed according to principle "2" is too low, several bases (preferably G or C bases) can be added to the 5 'end of the primer; One or several A bases can also be added at the 3 'end; Alternatively, both the 5 'and 3' ends can be modified simultaneously.5.If the Tm value of a primer designed directly according to principle "2" is too high, several bases can be removed from the 5 'or 3' end of the primer.Notes:1. Before using the reagent, please gently mix it upside down to avoid foaming, and use it after a brief centrifugation.2. The amount of miRNA first strand cDNA added should not exceed 10% of the volume of Real time PCR.3. For special detection systems, high content of cDNA templates can easily lead to non-specific amplification. Dilute cDNA appropriately (10 or 100 times dilution) based on the abundance of detected miRNAs.4. The 2x miRNA qPCR Mixture in this product contains SYBR Green I and ROX dyes. When storing this product or preparing PCR reaction solution, strong light exposure should be avoided.5. Avoid repeated freezing and thawing of this product. Repeated freezing and thawing may cause a decrease in product performance. This product can be stored at -20 ℃ for long-term storage. If frequent use is required in the short term, the 2xmiRNA qPCR Mixture can be stored at 2-8 ℃. However, the Reverse primer still needs to be stored at -20 ℃.Operation steps:1. Melt 2 x miRNA qPCR Mixture and Reverse Primer at room temperature (10 µ M). 2. When using, please gently mix the 2x miRNA qPCR Mixture upside down to avoid foaming, and use after brief centrifugation. If the reagent is not well mixed, its reaction performance will decrease.3. Place the reagent on ice and prepare the reaction system according to the following table: reagent volume final concentration 2×miRNA qPCR Mixture（ROX） 10 µl 1× Forward primer（10 µM） 0.4µl 0.2 µM Reverse primer（10 µM） 0.4µl 0.2 µM MiRNA first strand cDNA X µl — ddH2O up to 20 µl —4. The reaction program is set as follows:Attention!The pre denaturation reaction of this product must be completed at 95 ℃ for 10 minutes! Note: 1) The hot start enzyme used in this product must be activated under pre denaturation conditions of 95 ℃ and 10 minutes.2) The annealing temperature should be set at 60-64 ℃ as a reference range. When non-specific reactions occur, the annealing temperature can be increased... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |